Research Article, J Otol Rhinol Vol: 6 Issue: 2
Promoter Methylation of Dual Specificity Phosphatase-6 Gene effect on Invasion and Metastasis of Nasopharyngeal Carcinoma
| Yang JH1 and Zhang S2* |
| 1Central laboratory, Shenzhen, Guang Dong, China |
| 2Department of Otolaryngology, Guang Ming New District People’s Hospital of Shenzhen, China |
| Corresponding author : Song Zhang Department of Otolaryngology, Guang Ming New District People’s Hospital of Shenzhen, Song Bai Road 5342#, Shenzhen, Guang Dong, TX 518106, PR China Tel: 527548815 Fax: +86-075527546030 E-mail: zhangsongent@foxmail.com |
| Received: January 27, 2017 Accepted: February 22, 2017 Published: March 01, 2017 |
| Citation: Yang JH, Zhang S (2016) Promoter Methylation of Dual-Specificity Phosphatase-6 Gene effect on Invasion and Metastasis of Nasopharyngeal Carcinoma. J Otol Rhinol 6:1. doi: 10.4172/2324-8785.1000307 |
Abstract
Objective: The dual-specificity phosphatase-6 (DUSP-6) is a member of dual-specificity protein phosphatase (DUSP) family, it can make residues of threonine and tyrosine dephosphorylate. In recent years, it was found that DUSP-6 is correlated with tumour generation and progress. In this study we have detected the effect of DUSP-6 gene methylation on invasion and metastasis of nasopharyngeal carcinoma.
Methods: RT-PCR and methylation-specific PCR are used to detect mRNA expression and methylation state of DUSP-6 gene in nasopharyngeal carcinoma tissues and CNE2 cell line. The changes of mRNA expression and methylation state of DUSP-6 gene, proliferation and invasion of cells were detected after 5-aza- 2’-deoxycytidine (5-aza-cdR) treated CNE2 cell line.
Results: These results showed that DUSP-6 gene expression is related to its promoter methylation state, cervical lymph node metastasis is related to DUSP-6 gene promoter methylation state in patients with nasopharyngeal carcinoma, 5-aza-cdR can inhibit invasion of CNE2 cells, and make re-expression of DUSP-6 gene by promoter demethylation in CNE2 cells.
Conclusion: DUSP-6 gene promoter methylation state is possibly an important factor that effected invasion and metastasis of nasopharyngeal carcinoma. DUSP-6 gene may make a novel marker for prognostic evaluation in nasopharyngeal carcinoma.
Keywords: Dual-specificity phosphatase; Methylation; Nasopharyngeal,carcinoma; CNE2 cell line invasion; 5-aza-2’-deoxycytidine; Metastasis
Keywords |
|
| Dual-specificity phosphatase; Methylation; Nasopharyngeal carcinoma; CNE2 cell line invasion; 5-aza-2’-deoxycytidine; Metastasis | |
Abbreviations |
|
| DUSP: Dual-Specificity Protein Phosphatase; DMSO: Dimethyl Sulphoxide; MAPK: Mitogen-Activated Protein Kinase; 5-aza-cdr: 5-Aza-2’-Deoxycytidine. | |
Introduction |
|
| The dual-specificity phosphatase (DUSP) belongs to family of protein group which is able to dephosphorylate the residues of threonine/serine and tyrosine. All DUSPs contain a common phosphatase domain with conserved aspartic acid, cysteine, and arginine residues forming the catalytic site. A subset of DUSPs contains an N-terminal region composed of two CDC25 homology 2 domains and an intervening cluster of basic amino acids known as the MAP kinase-binding (MKB) motif or kinase-interacting motif (KIM); this MKB/KIM motif of DUSP interacts with the common domain of MAP kinases to mediate the enzyme-substrate interaction [1]. Now 25 genes were found in the human dual-specificity phosphatase family. DUSP-6 is a member of DUSP family. It plays a major role in embryonic development [2]. Many studies demonstrated that DUSP- 6 is related with progression and resistance of cancer. Xu found that Dusp-6 gene is often under-expressed because of its promoter hypermethylation in pancreatic cancer tissues and cell lines [3]. High expression of DUSP-6 was also reported in keratinocytes and breast cancer cells [4]. Under-expression of DUSP-6 gene was also found in lung cancer, and restoration of its expression resulted in suppressed tumor growth [5]. | |
| Nasopharyngeal carcinoma (NPC) is a frequent tumor in southern China and its etiopathogenesis is not clear. It may be caused by a variety of factors; very recently, many studies have found that DUSP-6 expression is related with some cancer progression. In this study, we have detected the methylation state and expression of DUSP-6 gene in nasopharyngeal carcinoma tissues and CNE2 cell linea nasopharyngeal carcinoma cell line). No expression of DUSP- 6 mRNA was found in nasopharyngeal carcinoma tissues of DUSP- 6 gene hypermethylation and CNE2 cell line. Strong expression of DUSP-6 mRNA was found in nasopharyngeal carcinoma tissues of DUSP-6 gene hepomethylation and chronic nasopharyngitis tissues. Then, the CNE2 cells were treated by using 5-aza-2’-deoxycytidine. Demethylation and re-expression of DUSP-6 gene was found, ability of cell invasion were inhibited in CNE2 cells. | |
Materials and Methods |
|
| Tissue samples | |
| Thirty-eight cases of nasopharyngeal carcinoma and thirteen cases chronic nasopharyngitis were included in the study. All biopsies were obtained from patients with nasopharyngeal carcinoma or chronic nasopharyngitis with consent before treatment at the Department of Otolaryngology, Guang Ming New District People’s Hospital of Shenzhen. All specimens were subjected to histological diagnosis by a pathologist. On the basis of TNM stage classification (UICC 2002), 10 patients had stage I disease (26.3%), 11 patients had stage II disease (28.9 %), 12 patients had stage III disease (31.6%), 5 patients had stage IV disease (13.2%). In the cases of nasopharyngeal carcinoma, 36 patients had cervical lymph node metastasis, 12 patients had no cervical lymph node metastasis. | |
| Cell culture | |
| The CNE2 cell line, a nasopharyngeal carcinoma cell line was obtained from the China Center for Type Culture Collection. It is originated in a poorly differentiated nasopharyngeal carcinoma tissue. CNE2 cells was cultured in RPMI-1640 medium supplemented with 10% (v/v) fetal bovine serum at 37°C in 5% CO2. | |
| Cell proliferation assay | |
| In our previous study, when the 5-aza-2’-deoxycytidine (5-aza- CdR) concentration is 80 μmol/L, the inhibition rate of cells proliferation is almost 50% in the CNE2 cell line [6]. So, the 80 μmol/L as experimental drug concentration was used in the study. The CNE2 cells were seeded into five 96-well culture plates with the same cell count in per well (103 cells per well). There are two row cells and one row blank well only contain medium in each 96-well. The two row cells were respectively treated by using 0 μmol/L or 80 μmol/L 5-aza- 2’-deoxycytidine after the cells were seeded 24 hours. After the cells were treated 24 hours, 50 μl of MTT solution (5 mg/ml) was added in two row cells in one of five 96-well plate. The absorbance values were measured by the method of our previous experiments [6]. The proliferation curve of each group cells was plotted on the basis of the absorption values. | |
| Boyden chamber matrigel invasion assay | |
| The invasive capacity of CNE2 cells was detected by using Boyden chamber Matrigel invasion assay according to the manufacturer’s protocol. In brief, added CNE2 cells to the upper and coated surface of the transwell inserts, conditioned medium was added to the lower well of the assay chamber. Cells that are invasive will invade through the matrix barrier, pass through the pores of the membrane, and migrate onto the lower surface of the filter. The invading cells were observed and counted at × 400 light microscopes. Then, ten random fields for each group cells were counted. The average number of cells was the number of invaded cells. | |
| Analysis of methylation status of DUSP6 gene promoter | |
| Genomic DNA from the CNE2 cells was extracted according to the instructions in reagent box. Genomic DNA was modificed by using a bisulfite modification reagent box (Methylation-Gold Kit). Modificated genomic DNA was amplified using two pairs of primers. Methylation-specific primers sequences for DUSP-6 gene were 5’- ATATAATTTGTTTTAGTCGGTTCGT-3’ (forward), 5’- GATTTACTATCTCTTAAACTCAACCTCG-3’ (reverse); Unmethylation-specific primers sequences for DUSP-6 gene were 5’- AATATAATTTGTTTTAGTTGGTTTGT -3’ (forward), 5’- CAATTTACTATCTCTTAAACTCAACCTCAC -3’ (reverse). Genomic DNA was amplified in a Life Express Thermal Cycler. Both annealing temperature of unmethylated and methylated reactions were 57°C. The PCR products were analyzed on a 3% agarose gel. The product amplificated from methylated primer sequences is 166 bp; the product amplificated from unmethylated primer sequences is 168 bp. | |
| Reverse transcription PCR | |
| The total RNA of CNE2 cells was isolated by using Trizol regent box. Reverse transcription PCR was performed by using TOYOBO THUNDERBIRD SYBR qPCR Mix kit follow the instructions. The primers either for DUSP-6 or β-actin gene were synthesized by Invitrogen Biotechnology Co, LTD. The primer for DUSP- 6: 5’- GTGTCTTGGTACATTGCTTGGC-3’ (forward) and 5’- GTCATAGGCATCGTTCATCGAC-3’ (reverse). The primer for β-actin: 5’-GTCCACCGCAAATGCTTCTA-3’ (forward) and 5’-TGCTGTCACCTTCACCGTTC-3’ (reverse). The PCR products were analyzed on a 3% agarose gel. | |
| Western blot analysis | |
| Total protein of CNE2 cell lines was extracted by using Protein Extraction Kit. Western Blot Analysis was performed and we followed our previous experiment [6]. In short, this experiment was completed by determination the protein concentration, SDS-PAGE electrophoresis, transferred protein to a PVDF membrane, immune response and chemiluminescence detection steps. | |
| Statistical analysis | |
| All data were analyzed by using the SPSS 17.0 statistical software for Windows. The difference of invasive capacity of CNE2 cells was assessed by using the t test. P values less than 0.05 were considered significant difference. | |
Results |
|
| Methylation status of Dusp-6 genes in the nasopharyngeal cancer and chronic nasopharyngitis tissues | |
| Methylation of Dusp-6 gene promoter was found 29 of 38 (76.3%) in nasopharyngeal cancer tissues. No methylation of Dusp-6 gene promoter was found in chronic nasopharyngitis tissues (Figure 1). The chi-square test showed that there was no significant difference in promoter methylation rate among samples from patients with different TNM stages (χ2=3.217,P=0.105). In contrast, a significant difference was found between specimens from patients with cervical lymph node metastasis (24/26) and without cervical lymph node metastasis (5/12) (χ2 =13.216, P=0.000). | |
 |
Figure 1: DUSP-6 gene methylation state in the nasopharyngeal carcinoma and chronic nasopharyngitis tissues Lane M, Amplified product with primers recognizing methylated sequences; Lane U, Amplified product with primers recognizing unmethylated sequences；Tm，nasopharyngeal carcinoma tissues with DUSP-6 gene methylation；Tu，nasopharyngeal carcinoma tissues with DUSP-6 gene unmethylation；CN，chronic nasopharyngitis tissues. |
| Dusp-6 mRNA expressions in the nasopharyngeal cancer and chronic nasopharyngitis tissues | |
| No or low Dusp-6 mRNA expression was detected in all nasopharyngeal cancer tissues with promoter methylation. Strong expression of Dusp-6 mRNA was found in all nasopharyngeal cancer tissues with promoter unmethylation and chronic nasopharyngitis tissues (Figure 2). | |
|
Figure 2: mRNA expression of DUSP-6 gene in the nasopharyngeal carcinoma and chronic nasopharyngitis tissues, A: mRNA expression of DUSP-6 gene in the nasopharyngeal carcinoma and chronic nasopharyngitis tissues；B: mRNA expression of β-actin gene in the nasopharyngeal carcinoma and chronic nasopharyngitis tissues； Tm，nasopharyngeal carcinoma tissues with DUSP-6 gene methylation；Tu，nasopharyngeal carcinoma tissues with DUSP-6 gene unmethylation；CN，chronic nasopharyngitis tissues. |
| The change of cells proliferation before and after 5-aza-cdr treatment | |
| Form the proliferation curve of CNE2 cells; we know that cells proliferation was inhibited in the CNE2 cells treated with 5-aza- 2’-deoxycytidine as compared with the cells without any treatment (Figure 3). It showed that 5-aza-cdr inhibit CNE2 cells proliferation. | |
|
Figure 3: The proliferation curve of CNE2 cells, The proliferation curve showed that 5-aza-2’-deoxycytidine inhibited CNE2 cells proliferation. |
| The change of cells invasion capacity before and after 5-azacdr treatment | |
| From the results of Boyden chamber Matrigel invasion assay, we know that the invading cells number was x̄ =8.50 ± 0.97 treated with 5-aza-cdr, the invading cells number was x̄ =11.80 ± 1.23 in the CNE2 cells without any treatment. There is significant difference (t=6.659, p=0.000 (Figure 4). | |
|
Figure 4: Effect of 5-aza-cdr on invasion capacity of CNE2 cells, A: The CNE2 cells without any treatmen. B: The CNE2 cells treated by 80 μmol/L 5-aza-2’-deoxycytidine. The figure demonstrated that 5-aza-2’-deoxycytidine inhibited invasion capacity of CNE2 cells. |
| The change of methylation state of DUSP-6 gene before and after 5-aza-cdr treatment in CNE2 cells | |
| Methylation state of DUSP-6 gene was analyzed by methylationspecific PCR in CNE2 cells. DUSP-6 gene promoter hypermethylation was found in CNE2 cells without any treatment. However, DUSP- 6 gene promoter was demethylation in CNE2 cells treated with demethylation agent 5-aza-cdr (Figure 5). | |
|
Figure 5: Effect of 5-aza-cdr on methylation state of DUSP-6 gene in CNE2 cells Lane M, Amplified product with primers recognizing methylated sequences; Lane U, Amplified product with primers recognizing unmethylated sequences. 0 μmol/L: The CNE2 cells without any treatment. 80 μmol/L: The CNE2 cells treated by 80 μmol/L 5-aza-cdr. It showed that DUSP-6 gene methylated was demethylated by 5-aza-cdr in CNE2 cells. |
| The change of DUSP-6 gene expression before and after 5-Aza-cdr treatment in CNE2 cells | |
| The mRNA and protein expression of DUSP-6 were detect by using reverse transcription PCR and western blot in the CNE2 cells. These results demonstrated that strong expression of DUSP6 mRNA and protein were found after treatment with 5-Aza-cdr in the CNE2 cells (Figures 6 and 7). It suggests that the down-regulation of DUSP- 6 gene expression correlates with its promoter methylation in CNE2 cells. | |
|
Figure 6: Effect of 5-aza-cdr on mRNA expression of DUSP-6 gene in CNE2cells. A: mRNA expression of DUSP-6 gene in CNE2 cells. B: mRNA expressionof β-actin gene in CNE2 cells. 0 μmol/L: The CNE2 cells without anytreatment. 80 μmol/L: The CNE2 cells treated by 80 μmol/L 5-aza-cdr. Itwas found that restoration of DUSP-6 mRNA expression in CNE2 cells aftertreated by 5 aza cdr. |
|
Figure 7: Effect of 5-aza-cdr on protein expression of DUSP-6 gene in CNE2 cells 0 μmol/L: The CNE2 cells without any treatment. 80 μmol/L: The CNE2 cells treated by 80 μmol/L 5-aza-cdr. It was found that restoration of DUSP-6 protein expression in CNE2 cells after treated by 5-aza-cdr. |
Discussion |
|
| NPC is a common malignant tumor of squamous cell carcinoma studied in otolaryngology. They arise from the lateral wall surface of nasopharynx [7]. It has a very high incidence in southern region of China. Radiotherapy is a common means of treatment for NPC. Although equipment and technology of radiotherapy is constantly updated and followed the progress of science and technology. But the cure rate and survival quality of patients with nasopharyngeal carcinoma has no obviously improved. The basic reason is that the pathogenesis of nasopharyngeal cancer is still unclear. One elemental factor mediating the biological behaviors of NPC including carcinogenesis is the alteration of intracellular compartment signaling. Recent studies have found that some signal transduction pathways play a crucial role in cell survival, growth, metastasis [8]. The mitogen-activated protein kinase (MAPK) pathway contains a chain of proteins in the cell. It communicates a signal by phosphorylating various transcription factors. Both c-Jun N-terminal kinase (JNK) and extracellular signal-related kinase (ERK) are members of the MAPKs. Cowan found that they play an important role in cancer development [9]. Because the DUSP family proteins are able to dephosphorylate both the threonine/serine and tyrosine residues, they were named for dual-specificity phosphatase [1]. Recently, some articles have demonstrated the possible roles of DUSPs in malignant tumor therapy [10], and have detailed the regulation of MAP kinases by DUSPs [11]. | |
| The DUSP-6 is a member of dual-specificity protein phosphatase (DUSP) family. Many studies have demonstrated that DUSP-6 is related to cancer progression and resistance [3-5]. Bermudez reported that down regulation of ERK signaling, suppression of cell growth, and increased apoptosis in cancer cell after the re-expression of DUSP-6 through adenoviral infection. DUSP-6 effect on cellular proliferation and differentiation results in negatively regulates members of the mitogen-activated protein (MAP) kinase superfamily (e.g.,ERK, JNK, p38) [10]. Xu found that under expressed of DUSP-6 is related with hypermethylation of gene promoter in pancreatic cancer tissues and cell lines [3]. DNA methylation is one of epigenetic regulation of genes. Gene activity is related to its promoter methylation status [12,13]. Different DNA methylation status plays different roles in tumor formation [14]. In recent years, the inactivation of tumor suppressor gene caused by its promoter methylation has become a hot spot in occurrence and development of cancer. In some studies, promoters hypermethylation of cancer-related genes were frequently found in a variety of human cancers [15,16]. | |
| In present study, mRNA expression of DUSP-6 gene is related to its promoter methylation state in the nasopharyngeal carcinoma and chronic nasopharyngitis tissues, methylation state of DUSP- 6 gene is related to cervical lymph node metastasis in the patients with nasopharyngeal carcinoma. Hypermethylation of DUSP-6 gene promoter was found in the CNE2 cells. Loss expression of DUSP-6 gene was detected by using RT-PCR and western blot in the CNE2 cells. After 5-Aza-cdr treatment, DUSP-6 gene promoter was demethylated, re-expression of DUSP-6 gene was found in the CNE2 cells. These results demonstrated that expression of DUSP- 6 gene is concerned with its promoter methylation state. The loss expression of DUSP6 gene caused by promoter hypermethylation can be reversed by using 5-Aza-cdr treatment. 5-Aza-cdr is a DNA methyltransferase inhibitor. It makes hypermethylation genes demethylate in course of DNA copy [17]. The previous study found that loss expression of DAPK and SOX11 gene is associated with its promoter hypermethylation in the CNE2 cells and laryngeal Hep-2 cells [6,18,19]. | |
| In this study, cells proliferation test showed that 5-Aza-cdr inhibited cells proliferation in the CNE2 cells. Boyden chamber Matrigel invasion assay demonstrated that 5-Aza-cdr inhibited invasive ability of cells in the CNE2 cell line. Coupled with the results of the above, it showed that 5-Aza-cdr inhibit proliferation and invasion of CNE2 cells, it is possibly because 5-Aza-cdr make re-expression of DUSP-6 gene silenced through DNA methylation. In previous study, proliferation and invasion of CNE2 cells were significantly inhibited, re-expression of DAPK and SOX11 genes were found after 5-Aza-cdr treatment. It is possibly because 5-Aza-cdr makes tumor suppressor gene promoter demethylation, restoration expression of tumor suppressor gene resulted in suppressed proliferation and invasion of cancer cells. DUSP-6 is one of tumor suppressor genes. It possibly plays a role in proliferation, invasion and metastasis of CNE2 cells. | |
Conclusion |
|
| DUSP-6 gene expression is related to its promoter methylation state. 5-aza-2’-deoxycytidine can inhibit proliferation and invasion of CNE2 cells, and make re-expression of DUSP-6 gene by promoter demethylation in CNE2 cells. DUSP-6 gene promoter methylation state possibly plays an important role in invasion and metastasis of CNE2 cells. | |
Author’s contributions |
|
| Song Zhang designed the research, supervised all experiments, and drafted this paper. Ju-Hong Yang executed all experiments. All authors read and approved the final manuscript. | |
Acknowledgments |
|
| This project was supported by Shenzhen science and technology innovation committee funding program (series number: JCY20150402161136231). | |
References |
|
|
|
