Journal of Veterinary Science & Medical Diagnosis ISSN: 2325-9590

All submissions of the EM system will be redirected to Online Manuscript Submission System. Authors are requested to submit articles directly to Online Manuscript Submission System of respective journal.

Research Article, J Vet Sci Med Diagn Vol: 6 Issue: 2

cDNA Cloning and Distribution of Neuromedin U and its Receptor in the Rabbit

Ejlal Ahmed Mohammed, Zhi-yu Ma and Zhi-hai Lei*

College of Veterinary Medicine, Nanjing Agricultural University, Nanjing, Jiangsu Province, China

*Corresponding Author : Zhi-hai Lei
College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210095, PR China
Tel +86-025- 84397619
Fax: +86-025-84398669
E-mail: [email protected]

Received: March 23, 2016 Accepted: February 15, 2017 Published: February 19, 2017

Citation: Mohammed EA, Ma ZY, Lei ZH (2017) cDNA Cloning and Distribution of Neuromedin U and its Receptor in the Rabbit. J Vet Sci Med Diagn 6:2.doi: 10.4172/2325-9590.1000225

Abstract

Neuromedin U (NMU) is a kind of peptides that was initially purified from the porcine spinal cord. There are two peptides NMU-25 and NMU-8 with similar biological functions. NMU is found in peripheral organs such as gastrointestinal (GI) tract and the central nervous system (CNS). NMU has two receptors NMU-R1 and NMU-R2.
NMU-R1 is expressed particularly in the various peripheral tissues, whereas NMU-R2 is expressed in the central nervous system. However, the expression and function of NMU in the rabbit remained unclear. In this study, a novel partial cDNA cloning and expression of NMU, NMU-R1 and NMU-R2 mRNAs in 30 rabbit tissues
were investigated using semi-quantitative RT-PCR. The specific fragments were amplified and target cDNA fragment lengths were 443, 366 and 203 bp, respectively consistent with the expected size of the fragment, and clear bands. The cDNA cloned of rabbit NMU, NMU-R1 and NMU-R2 sequences were found to be 84%, 84% and 87% identical to those of the corresponding human homologues, respectively. The rabbit NMU, NMU-R1 and NMU-R2 cDNAs were encoded as 147,122 and 67 amino acid sequences, respectively. Meanwhile, the rabbit NMU-R1 and NMU-R2 amino acid sequence were found to have a typical transmembrane structure of GPCR.
The results of RT-PCR analysis showed that the expression of NMU, NMU-R1 and NMU-R2 mRNAs was found in the central nervous system and in the peripheral tissues, whereas NMU mRNAs were more abundant in the peripheral tissues. These results revealed that the NMU, NMU-R1 and NMU-R2 mRNAs were expressed in rabbit tissues in various distribution patterns. The study provided the experimental data for further research on the physiological function of NMU and its mechanisms of action in rabbits.

Keywords: NMU; NMU-R1; NMU-R2; cDNA cloning; Sequence analysis; Gene expression

Introduction

Neuromedin U (NMU) is a neuropeptide that was initially isolated from porcine spinal cord. There are two peptides NmU- 25 and NmU-8 with identical biological activities and known for their strong contractile activity in the uterus [1,2]. NMU has four molecular forms are identified as NMU-25, NMU-8, NMU-9 and NMU-23, which were purified from a wide range of species such as porcine (NMU-8 and NMU-25) [1], dogs (NMU-8 and NMU-25) [3], Guinea pigs (NMU-9) [4], rats (NMU-23) [5], rabbits (NMU-25) [6], humans (NMU-25) [7] and goldfishes (gfNMU-21, gfNMU-25 and gfNMU-38) [8]. Various physiological functions of NMU have been reported, including smooth-muscle contraction, regulation of blood pressure [1], the stress response [9], ion transport [10], food intake and body weight reduction [11] and immune regulation [12]. NMU has been found in numerous species, especially in mammals, which indicate that this peptide is playing an essential biological role [13]. NUM is distributed widely in mammalian species with more abundant expression in gastrointestinal (GI) tract and central nervous system (CNS) [14-16]. Several studies have been shown the expression of NMU in different tissue. In human, the mRNA was detected in the intestine, pituitary gland, stomach and various brain regions involving locus coeruleus, medulla oblongata, hypothalamus, substantial nigra and thalamus [12,17,18]. The expression of NMU mRNA has been found in the lymphoid cells, including dendritic cells, monocytes and B cells, which revealed that the NMU plays a major role in the regulation of immune functions [12,19]. The result of NMU mRNA expression in rat’s tissue has shown similarities as that found in human tissues and NMU mRNA was detected in the small intestine, rectum, colon, pituitary gland and the genitourinary tract [7,20,21]. Moderate NMU mRNA expression has also been found in different regions of rat CNS [15,22,23]. There are two receptors for NMU namely NMU-R1 and NMU-R2, which have a distinct pattern of distribution. NMU-R1 is expressed in various peripheral tissues, while NMU-R2 is predominantly expressed in the CNS [11]. Previous studies on cloning of the murine NMU receptors demonstrate that the mouse and human NMU receptors have identical functional characteristics with a different distribution pattern [24]. Rabbit NMU-25 cloning has been reported in 1991s [6]. Except mice and rats, rabbits are the third most common laboratory animal used in the veterinary in research. Rabbit gene sequences are highly identical to human sequences than in rodent ones, since rodent sequences evolved more rapidly. Rabbit has an exact staging of early embryonic development and maternal pregnancy stages. In addition, placental morphology and function of rabbit are comparable to human [25]. However, to date, there is no information about the cDNA cloning and distribution of NMU in the rabbit. In this study, we report the partial cDNA cloning and distribution of NMU and its receptor in the rabbits. Subsequently, NMU, NMU-R1 and NMU-R2 mRNA expression in the rabbits were detected by semi-quantitative (RT-PCR).

Materials and Methods

Animals

Rabbit four month-old, male and female (n=4), weighing 2 Kg, were used in this experiment. The rabbits were sacrificed by decapitation. Thirty (30) tissues were collected and stored at -80°C until RNA, isolation was performed. Animal studies were carried out strictly in accordance with the instruction of the Nanjing Agricultural University Ethical Committee and procedures for experimental animals.

Total RNA extraction and cDNA synthesis

Total RNA was purified using Trizol reagent protocol (Thermo Fisher Scientific. U.S.A) treated with DNase to remove DNA contamination. The absorbance was measuring by a photometer (Eppendorf Photometer, Germany), to determine the RNA quality and concentration. Agarose gel electrophoresis and ethidium bromide staining was used to confirm RNA integrity. The cDNA was synthesized with RNAs by Promega kit protocol (Promega Corporation, U.S.A).

cDNA cloning and sequence analysis

The specific PCR primer was designed using primer premier 5.0 software. The rabbit NMU, NMU-R1 and NMU-R2 cDNA were amplified by PCR, using primers based on the predicted sequences of pig, sheep, and human. The sequences of the PCR primers were selected from the highly homologous part to establish the optimal reaction conditions. The sequences of the PCR primers used in this experiment are listed in Table 1. PCR was obtained utilizing Taq plus DNA polymerase (Vazyme Biotech Co., Ltd.). in a reaction volume of 25 μL, as follows: initial denaturation at 94°C for 5 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 30 s; and a final extension at 72°C for 7 min. PCR products were extracted using the Gel/PCR DNA fragments Extraction Kit (TaKaRa, Otsu, Japan), and ligated into the pUM19-T vector (Vazyme Biotech Co., Ltd.). The recombinant plasmid was transformed into competent Escherichia coli DH5 α cells. To confirm appropriate insertion, the cDNA clones were sequence using vector primers (Yingjun Biotech Ltd., China), and the sequences were submitted to GenBank.

National center for biotechnology information basic local alignment search tool (http://www.ncbi.nlm.nih.gov/blast) was used to perform the homology search and the identity/similarity assessment. The transmembrane domains were predicted using TMHMM (http:// www.cbs.dtu.dk/services/TMHMM-2.0). The alignment was obtained using the ClustalW algorithm, and the phylogenetic analysis was achieved using the neighbor joining method in MEGA 4.0.

Determination of the tissue distribution of NMU, NMU-R1, and NMU-R2 mRNA by semi-quantitative RT-PCR

PCR was performed using pairs of specific primers (Table 1). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA was used as reference. The primers for GAPDH mRNA were based on the rabbit GAPDH cDNA sequence obtained from GenBank (GenBank ID: NM 001082253.1) (Table 1). The PCR conditions were as follows: initial denaturation at 94°C for 5 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 30 s; and a final extension at 72°C for 7 min. Band intensities were analyzed using the Kodak ID Electrophoresis Documentation and Analysis System120 (Eastman Kodak Rochester, NY, USA).

Genes Primer sequence(5’-3’) Annealing(°c) Length (bp)
NMU Forward  CTTGCCCTTCCTGTCTG
Reverse CCATAGCATTGCCTCTGTA
56 443
NMU-R1 Forward CCCACCAACTACTACCTCTTCAGCC
Reverse  CACCACGACCAGCACAAACAGCAT
63 366
NMU-R2 Forward  ACCGCTGCTAGTTCAAGACGG
Reverse  CCTCCACTCCACAAAGCTG
56 203
GAPDH Forward  AGGTCGGAGTGAACGGATTTG
Reverse  CAGTCTTCTGGGTGGCAGTGAT
56 549

Table 1: Primers used for cDNA cloning and tissue distribution.

Statistical analysis

All data are presented as the mean ± standard error of the mean (SEM). The statistical analysis was performed using one-way ANOVA and the independent sample t-test with SPSS Statistics 17.0.

Results

cDNA cloning and sequence analysis

In this study, we cloned the rabbit NMU, NUM-R1 and NMU-R2 cDNA fragments using RT-PCR. Specific fragments were amplified and target cDNA fragment lengths were 443, 366 and 203 bp, respectively (Figure 1A, B and C), consistent with the expected size of the fragment, and clear bands. These fragments were confirmed by sequencing, and NMU, NMU-R1 and NMU-R2 sequences were submitted to GenBank (GenBank IDs: KP276160.1, KM-236787.1 and KM-236788.1). NCBI database map views program analysis showed that the rabbits NMU, NMU-R1 and NMU-R2 gene were located on chromosome 2, 3 and 1 respectively. The sequence analysis showed that rabbit NMU exhibited an open reading frame (ORF) of 564 nucleotides encoding 147 amino acids residues, while NMU-R1 included 360 nucleotides encoding 122 amino acids residues, and NMU-R2 gene included 288 nucleotides encoding 67 amino acids residues. The rabbit NMU, NMU-R1 and NMU-R2 cDNA sequences were 84%, 84% and 87% identical to those of the corresponding human homologues, respectively. The homology of the nucleotide and amino acid sequences are compared in Tables 2-4. Multiple alignment analysis of the amino acid sequences indicated that the rabbit NMU, NMU-R1 and NMU-R2 were relatively conserved in humans, mice, cows, pigs, rats and sheep (Figures 2-4). Phylogenetic analysis revealed that the NMU coding sequences are highly conserved between the related species (Figure 5). Phylogenetic analysis elucidated the evolutionary relationship of the rabbit NMU-R1 and NMU-R2 sequence (Figures 6 and 7). The cross- model analysis showed that the rabbit NMU-R1 and NUM-R2 amino acid sequences displayed typical transmembrane features (Figures 8 and 9).

Figure 1: Reverse transcriptase-PCR results of the rabbit NMU, NUM-R1 and NMU-R2 genes.

Species GenBank ID Identity Percentage (%)          
Nucleotide  Amino acid
Homo sapiens XM 011534368.1/NP 006672.1 83                          84
Bostaurus XM 005207972.2/ELR 54045.1 83                         73
Susscrofa XM 003129032.3/AIC 38339.1 80                          75
Ovisaries XM 012170775.1/ XP 012065876.1 80                         74
Musmusculus BC 138071.1/NP 062388.1 78                          73
Rattusnorvegicus NM 022239.2/NP071575.1 78                          72

Table 2: Comparison of NMU nucleotide sequences and amino acids between Rabbit and other species.

Species GenBank ID Identity Percentage (%) Nucleotide           Amino acid
Homo sapiens AF272362.1/NP_006047.3 87                     84
Bostaurus XM_ 588365.6/XP_588365.6 86                     84
Ovisaries XM_004005455.1/P_004005504.1 86                      83
Susscrofa XM_ 03133724.4/XP_003133772.3 84                    78
Mus musculus NM_010341.1/EDL40217.1 81                     75
Rattusnorvegicus AF242873.1/AAF82754.1 80                      75

Table 3: Comparison of NMU-R1 nucleotide sequences and amino acids between Rabbit and other species.

Species GenBank ID Identity Percentage (%)     
Nucleotide Amino acid
Susscrofa FJ158599.1/XP_005658631.1    89                     90
Ovisaries XM_004008998.1/XP_004009047.1    89                     88
Homo sapiens AF272363.1/NP_064552.3    85                     87
Bostaurus XM_ 01035048.1/XP_005209706.1    83                    87
Musmusculus NM_153079.4/NP_694719.2    80                   75
Rattusnorvegicus NM_022275.3/EDM04491.1                    82                  76

Table 4: Comparison of NMU-R2 nucleotide sequences and amino acids between Rabbit and other species.

Figure 2: Multiple alignments of the deduced amino acid (aa) sequences of the Rabbit NMU with other species. Homo sapiens (Genbank ID: NP 006672.1), Mus musculus (Genbank ID: NP 062388.1), Sus scrofa (Genbank ID: AIC 38339.1), Bos taurus (Genbank ID: ELR 54045.1), Rattus novegicus (Genbank ID: NP071575.1).

Figure3: Multiple alignments of the deduced amino acid (aa) sequences of the Rabbit NMU-R1 with other species. Homo sapiens (Genbank ID: NP_006047.3), Sus scrofa (Genbank ID: XP_003133772.3), Mus musculus (Genbank ID: EDL40217.1), Rattus novegicus (Genbank ID: AAF82754.1).

Figure 4: Multiple alignment of the deduced amino acid (aa) sequences of the Rabbit NMU-R2 with other species. Homo sapiens (Genbank ID: NP_064552.3), Sus scrofa (Genbank ID: XP_005658631.1), Mus musculus (Genbank ID: NP_694719.2), Bos taurus (Genbank ID: XP_005209706.1).

Figure 5: Phylogenetic tree of NMU amino acids sequences.

Figure 6: Phylogenetic tree of NMU-R1 amino acids sequences.

Figure 7: Phylogenetic tree of NMU-R2 amino acids sequences.

Figure 8: Transmembrane regions for the rabbit NMU-R1 aa sequence fragment 1-56 aa and114-120 aa, outside sequence; 57-79 aa and 91-113 TMhelix sequence; 80-90 aa inside sequence.

Figure 9: Transmembrane region for the rabbit NMU-R2 aa sequence fragment 67-96 aa outside sequence; 44-66 aa TMhelix sequence; 1-43 aa inside sequence.

Expression of the NMU, NUM-R1 and NMU-R2 mRNA in various rabbit tissues

The NMU, NMU-R1 and NMU-R2 mRNA expression was detected by semi-quantitative RT- PCR in 30 tissues of the rabbit (Figure 10A and 10B). A high level of NMU mRAN expression was found in the ileum, testis, liver, rectum and hypothalamus. Moderate NMU mRNA expression was found in the duodenum, hippocampus, colon, parotid gland, adrenal gland, while other tissues showed a low level of NMU mRNA expression (Figure 10, A1 and B1). RT-PCR results showed that the highest levels of NMU-R1 mRNA expression were found in the peripheral tissues than that in the CNS. A high level of the NMU-R1 mRNA was mainly detected in the gastrointestinal tract, such as liver, colon, ileum cecum and sacculus rotundus. Moderate NMU-R1 mRNA expression was found in the pons, Hypothalamus, and spinal cord. While a low level of NMU-R1 mRNA expression was found in the cerebellum (Figures 10A2 and 10B2). According to the analysis of RT-PCR results a high level of NMU-R2 mRAN expression was detected in the hypothalamus, spinal cord, cerebellum, hippocampus, spleen, kidney, colon, ileum, mandibular gland, parotid gland and adrenal gland. Moderate NMU-R2 mRNA expression was found in the jejunum, sacculus rotundus, stomach, and uterus. While other tissues showed a low level of NMU-R1 mRNA expression (Figures 10A3 and 10B3).

Figure 10: Expression of NMU, NMU-R1, and NMU-R2 mRNAs in 30 rabbit tissues.
A:(A1, A2, and A3) Semi-quantitative RT-PCR was performed to measure the NMU, NMU-R1, and NMU-R2 mRNA transcript levels in 30 rabbit tissues. B: (B1, B2, and B3) Statistical analysis of NMU, NMU-R1, and NMU-R2 mRNA expression in the 30 rabbit tissues. Data are means ± SEM (n=3). 1. Medulla oblongata; 2. Pons; 3. Midbrain; 4. Hypothalamus; 5. Cerebellum; 6. Cerebral cortex; 7. Hippocampus; 8. Hypophysis; 9. Olfactory bulb; 10. Spinal cord; 11. Heart; 12. Liver; 13. Spleen; 14. Lung; 15. Kidney; 16. Stomach; 17. Duodenum; 18. Jejunum; 19. Ileum; 20. Cecum; 21. Colon; 22. Rectum; 23. Sacculus rotundus; 24. Mandibular gland; 25. Thymus; 26. Parotid gland; 27. Adrenal gland; 28. Ovary; 29. Uterus; 30. testis with GAPDH as endogenous reference.

Discussion

Several studies have demonstrated, identification and expression of NMU in various mammalian species such as pigs, humans and rats [1,7,16]. Two receptors of NMU have been specified and named NMU-R1 and NMU-R2, with a different distributional pattern [11]. However, gene cloning, tissues distribution and the physiological functions of NMU, NMU-R1and NMU-R2 remains unclear in domestic animals such as in the rabbits. In humans and veterinary research, Rabbit is usually used as an experimental model as compared with laboratory animal models such as the mouse and rat, the application of the rabbit is still limited. Rabbit can be used to associate the space between small animal models and larger animal models [25]. Therefore in this study, we performed cDNA cloning and expression of NMU, NMU-R1 and NMU-R2 mRNAs in 30 rabbit tissues by semi-quantitative RT-PCR and the results reveal that the NMU were considered to distribute and expressed in the gastrointestinal tract and central nervous system. In our study, we found that NMU has a common amino acid sequence (EKDNTKRFLFHYSKT) at the c-terminus in humans, mice, cows and pigs. The nucleotide sequence of rabbit NMU had high homology compared with other species such as humans, pigs, mice, cattle’s, sheep and rats (83%, 80%, 78%, 83%, 80% and 78%) respectively. The homology of the predicted amino acids was 84%, 75%, 73%, 73%, 74% and 72% identical to those of the corresponding humans, pigs, mice, cattle’s, sheep and rats. The NMU gene was located on chromosome 2. The NMU-R1 has 24 amino acid shares with other different species that are (YLFSLAVSDLLVLLVGLPLELYEM) and in NMU-R2 (SVLFSLPNTSIHGIK). The NMU, NMU-R1 and NMU-R2 gene sequence are a highly identical to the human homologue. These results indicated that the rabbit NMU, NMU-R1 and NMU-R2 gene may have the functional characteristic similar to their human homologues. A previous study of NMU expression has been demonstrated that in the rat, the highest levels of NMU expression were detected gastrointestinal tract and in the anterior pituitary [23,26]. While significant levels were detected in the central nervous system [27]. It is reported that NMU mRNA and NMU-LIR are profusely found in the pituitary gland in both the human and rat, which indicating that NMU has significant roles in this tissue [7,23,27]. In our experiment, we observed that the NMU, NMU-R1 and NMU-R2 mRNA was mainly distributed in the peripheral tissues and the central nervous system and. The highest levels of NMU mRNAs expression were found in the peripheral tissues such as ileum, testis and liver. The highest levels of NMU-R1 mRNAs expression were found in the liver, colon, ileum, cecum and sacculus rotundus. While the NMU-R2 mRAN expression was detected in the in the central nervous system and peripheral tissues, and the highest levels of NMU-R2 mRNAs expression was found in the hypothalamus. This is the basis to explore the tissue distribution of NMU and its receptor mRNAs in rabbits and distribution was detected in various tissues including the peripheral tissues and the central nervous system. The results indicated that the different distribution of NMU and its receptors suggest that they may have distinct physiological functions. However, further studies are needed in order to study the physiological function of NMU and its receptors in the rabbits.

Conclusion

In this study, we reported the cDNA cloning and expression of NMU and its receptor mRNAs in rabbits. The NMU, NMU-R1 and NMU-R2 cDNA fragments were cloned and the fragment size was 443, 366 and 203 bp, and the gene sequences were submitted to the GenBank database (GenBank ID: kp276160.1, KM-236787.1 and KM- 236788.1) respectively. The nucleotide and amino acid sequence of rabbit NMU and its receptor are highly homologous to other species and rabbit NMU-R1 and NMU-R2 has a typical transmembrane structure of GPCR. The NMU, NMU-R1 and NMU-R2 gene was located on chromosome 2, 3 and 1 respectively. The tissue expression of NMU, NMU-R1 and NMU-R2 mRNAs was found in the central nervous system and the peripheral tissues, and NMU mRNAs were more abundant in the peripheral tissues. The study provided not only amino acids which can be used for protein senses but also providing data for further research on the physiological function of NMU and its mechanisms of action in the rabbit.

Acknowledgement

The authors would like to thank all the colleagues for their assistance in laboratory and valuable discussions. This work was supported by National Nature Science Foundation of China (31372388) and the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).

References

Track Your Manuscript