Reach Us +1 850 754 6199

Journal of Veterinary Science & Medical Diagnosis ISSN: 2325-9590

All submissions of the EM system will be redirected to Online Manuscript Submission System. Authors are requested to submit articles directly to Online Manuscript Submission System of respective journal.

Research Article, J Vet Sci Med Diagn Vol: 7 Issue: 3

The irp2 Genes in High Pathogenicity Islands are Involved in the ROS Generation and Increases Antioxidase Levels in the PMNs Caused by Porcine Pathogenic Escherichia coli

Yulin Yan1*, Xiangfeng Li1,2, Zhaohui Wei1, Guowen Fu1, Hong Gao1*, Ru Zhao1, Zhi yong Shao1, Weijie Qu1 and Yongke Sun1

1College of Veterinary Medicine, Yunnan Agricultural University, Kunming, PR China

2Chuxion Animal Disease Prevention and Control Centre, Chuxiong, PR China

*Corresponding Authors : Yulin Yan
College of Veterinary Medicine, Yunnan Agricultural University, Kunming, PR China
E-mail: [email protected]

Hong Gao
College of Veterinary Medicine, Yunnan Agricultural University, Kunming, PR China
E-mail: [email protected]

Received: July 16, 2018 Accepted: August 04, 2018 Published: August 10, 2018

Citation: Yan Y, Li X, Wei Z, Fu G, Gao H, et al. (2018) The irp2 Genes in High Pathogenicity Islands are Involved in the ROS Generation and Increases Antioxidase Levels in the PMNs Caused by Porcine Pathogenic Escherichia coli. J Vet Sci Med Diagn 7:3. doi: 10.4172/2325-9590.1000260

Abstract

Polymorphonuclear leukocytes (PMNs) release large quantities of reactive oxygen species (ROS) to kill pathogens. Escherichia coli (E. coli) strains containing a Yersinia high-pathogenicity island (HPI) display increased virulence that is attributable to increased iron scavenging activity, which enhances bacterial growth and limits the availability of iron for use by innate immune cells. ROS generation requires the catalysis of iron. The irp2 gene has been confirmed to be the main gene involved in the synthesis of HPI. In the present study, the effect of pathogenic HPI-positive Yunnandominant (O152) E. coli strains on the respiratory oxidative stress response from PMNs in Yunnan Saba pigs were not explored. The results showed that E. coli containing the HPI can reduce ROS generation by competitively consuming iron in the surrounding environment, while inducing high levels of antioxidases in PMNs. We discovered a novel mechanism by which the HPI protects E.coli from ROS and enhances its virulence in PMNs. These results increase our understanding of the interaction between pathogenic E. coli and host PMNs in Saba pigs.

Keywords: Porcine pathogenic; Escherichia coli; irp2; PMNs; Respiratory burst

Introduction

Polymorphonuclear leukocytes (PMNs) are key components of the innate immune system and the first responders to infection or cell injury [1]. These cells play a key role in the host defense against invading pathogens and in inflammatory processes [2]. Within the first minutes of stimulation, PMNs release large quantities of highly toxic reactive oxygen species (ROS) during the so-called “respiratory burst” [3]. The production of ROS is a well-known and efficient microbicidal mechanism. In the presence of increased oxygen free radicals, the cell membrane permeability is disrupted, which is followed by the damage of cells and organelles [4]. Thus, PMNs play a unique role in the immune system as the first line of defense against infection [5].

The respiratory burst of PMNs is characterized primarily by the production of superoxide anion radicals (O2-) following a series of stimulating responses [6]. O2- is produced by the catalytic action of nicotinamide adenine dinucleotide phosphate (NADPH); however, O2-cannot cross the cell membrane [7]. The NADPH oxidase of the phagocyte, a multi-protein complex, exists in the dissociated state in resting cells, converts into the functional oxidase complex upon stimulation, and then generates O2- [8]. NADPH can also maintain the reduced state of glutathione (GSH). The antioxidant superoxide dismutase (SOD) can catalyze the O2- radical into hydrogen peroxide (H2O2). However, H2O2 has a low oxidative capacity and cannot kill the bacteria [9]. SOD plays an important role in balancing the oxidant and antioxidant effects [10]. SOD can protect cells from damage by removing ROS. Another antioxidant, glutathione peroxidase (GSHPx), can also catalyze H2O2 to H2O. GSH-Px is an important, widely expressed enzyme that protects the integrity of membrane structure and function [11].

The O2- radical and H2O2 together generates the highly active hydroxyl radical (·HO) via the Fenton type Haber-Weiss reaction [12,13]. The .HO can cause protein peroxidation, deoxyribonucleic acid (DNA) damage, and lipid peroxidation. The final products of lipid peroxidation are methane dicarboxylic aldehyde, which exhibits potent cytotoxicity [14]. The antioxidant effects mostly happen to non-phagocytes [9]. In PMNs, the majority of H2O2 is catalyzed into hypochlorous acid (HOCl) by the myeloperoxidase (MPO) in azurophilic granules. HOCl and .HO are the major efficient bactericidal products catalyzed from O2- and H2O2, respectively [15-17].

Escherichia coli (E. coli) contains Yersinia high-pathogenicity island (HPI), which encodes the potent virulent siderophore yersiniabactin [18]. The core functional domain of HPI is the irp2 gene, which mediates its iron-scavenging activity [19]. The increased virulence of bacteria containing an HPI may be explained by this increased iron-scavenging ability, which would enhance bacterial growth. Increased iron scavenging also limits iron availability to those cells of the innate immune system that require iron to catalyze the Haber-Weiss reaction, which produces .HO [1,20].

Saba pigs are the excellent local breed pigs in the Yunnan province in southwest China. In the present study, the effects of respiratory oxidative stress induced by dominant pathogenic E. coli containing an HPI from Yunnan strains (O152) was explored for PMNs from Yunnan Saba pigs. Cell counting was used to detect the population of PMNs. Chemiluminescence was used to detect the levels of total SOD (T-SOD), GSH-Px, and MPO at 4, 8, 12, 16, 20, and 24 h after PMN infection with E. coli. An enzyme-linked immunosorbent assay (ELISA) was used to determine the content of NADPH and ROS at different time points. An iron saturation assay was used to investigate whether the HPI-positive E. coli reduced the production of ROS via iron uptake.

Methods

Bacterial culture

E. coli of the O152 serotype was clinically isolated from the fecal samples of Yunnan Saba pigs. The isolated strains of E. coli O152 were stored of 50% glycerol stocks at -80°C. The strains were cultured on Luria-Bertani agar plates overnight at 37°C. Then, a single colony was picked and plated onto Luria-Bertani liquid medium at 37°C. The bacterial concentration was determined based on the optical density at 600 nm, which was between 0.6 and 0.8 colony-forming units (CFU). E. coli strains were then serially diluted and plated to enumerate CFU.

Construction of the HPI knockout strain

The construction of the HPI (irp2 gene) knockout strain was carried out using the Red recombinase system. Target segments were prepared with pKD3 using PCR. The primers P1 and P2 (Table 1) contain FRT and chloramphenicol resistance genes with the irp2 homologous recombination arm in the 5’ region of the forward and reverse primers. Competent cells were prepared by using E. coli O152. PCR products were purified using a gel extraction kit (BioTeke, Beijing). Purified PCR products were transformed into E. coli O152-competent cells containing pKD46. LB media containing chloramphenicol were used to screen positive strains at 30°C overnight. The pKD3 primers P3 and P4 (Table 1) was used to identify the positive colony, designated as HPI/ΔHPI/pKD46, which was cultured at 37°C for 16 hours to remove the plasmid pKD46. Primers P5 and P6 (Table 1) were used to confirm the removal of pKD46. The positive colony was designated as HPI/ΔHPI/Cl+. The plasmid pCP20 was transformed into HPI/ΔHPI/Cl+-competent cells to remove the chloramphenicol resistance gene. Primers P3 and P4 (Table 1) were used to identify the positive colonies, which were designated as ΔHPI. The identification of the knockout strain (ΔHPI) was performed using PCR for the irp2 gene (Table 1) and western blotting for the HMWP protein (HMWP1, 240 kDa; HMWP2, 228 kDa).

Primers Sequence (5’-3’) Product (bp)
P1 gtacattctgtcttaatgtcttggagaccttcctgtctgcccaaggtgtactagAGCGATTGTGTAGGCTGGAG 1162
P2 ttaggggatataggactgtttagattattaacatgatcttgatttaactttggtacTTAACGGCTGACATGGGAATTAG
P3 TACATTCTGTCTTAATGTC 1205
P4 GACTGTTTAGATTATTAACA
P5 TAGCGGATCCTACCTGAC 596
P6 ATCAGTTCCTGTGGGTCG
Irp2 F: CGCTGGTTAGCATTTCTGG 357
R: AATCTGTCCGGCGTTGAG

Table 1: Primers and sequences.

Cell culture and infection of PMNs with E. coli

The PMNs were isolated using a kit (TBD, Tianjin, China). The PMNs were added to a 6-well plate in Roswell Park Memorial Institute medium 1640 (RPMI 1640) with 10% fetal bovine serum (HyClone, USA) and antibiotics cultured in a 5% carbon dioxide incubator at 37°C.

HPI-positive E. coli was identified using polymerase chain reaction (PCR). The bacteria with and without HPI (ΔHPI) (multiplicity of infection (MOI)=200) were added to the PMNs. The bacteria were washed twice with phosphate-buffered saline (PBS) and resuspended in RPMI 1640. The PMNs were incubated at 37°C for 5 min before the addition of an equal volume of bacterial solution. The assay was further divided into three groups: the control group of the PMNs was exposed to an equal volume of antibiotic-free DMEM, the HPI-infected group, and the ΔHPI-infected group. The PMNs were cultured at 37°C in 5% carbon dioxide. The samples were collected at 4, 8, 12, 16, 20, and 24 h for subsequent experiments. Each of the experimental groups is with three replicates.

ELISA

The levels of NADPH and ROS were detected using an ELISA Kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s instructions.

Iron saturation assay: An iron saturation assay was used to investigate whether the HPI-positive E. coli could reduce the production of ROS through iron uptake. The PMNs were infected with E. coli with and without HPI. PMNs were treated with varying concentrations of deferoxamine (0, 5, 10, 20, 35, and 80 μm) (Novartis, Switzerland) and PBS (equivalent volume) for 4 h, and the ROS production was quantified.

Chemiluminescence assay: To assess the oxidative burst of PMNs induced by E. coli, chemiluminescence was used to detect the levels of T-SOD, GSH-Px, and MPO. The cell suspension and the cells were collected, and the T-SOD, GSH-Px, and MPO levels were detected using the xanthine oxidase assay, GSH-glutathione disulfide assay, and o-dianisidine method (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), respectively.

Statistical analysis: Analysis of variance and multiple comparison analyses were performed using SPSS software, Version 16.0. For duplicate determinations, the error bars to reflect one half of the range; otherwise, they reflect the standard error of the mean. A P value of <0.05 was considered statistically significant.

Results

Identification of the knockout strain (ΔHPI)

Identification of the knockout strain (ΔHPI) was performed by PCR detection of the irp2 gene (357 bp) and western blotting for the HMWP protein (HMWP1, 240 kDa; HMWP2, 228 kDa) (Figure 1). The screening for the irp2 gene in the knockout strain (sample 2) was negative (Figure 1A), which demonstrated that irp2 was successfully deleted. In addition, the western blot identification of the HMWP protein in the knockout strain (sample 3) (Figure 1B) was also negative. The above results demonstrated that the knockout strain (ΔHPI) was created successfully.

Figure 1: Identification of the knockout strain (ΔHPI) (A) PCR identification of the irp2 gene: The detection of ΔHPI (sample 2) was negative. (M: DL 2000 bp Maker; 1: Positive control; 2: Knockout strain); (B) Western blot identification of the HMWP protein: The HMWP protein in was not detected in the (Sample 3). M: 250 kDa Maker; 1: Blank control; 2: Positive control; 3: Knockout strain.

Isolation of the PMNs

The purity of the isolated PMNs by Wright Giemsa staining is shown in Figure 2A. The feature of the PMNs is karyolobism could be clearly observed. The PMNs were 95% pure. And the viability of the cells stained by Trypan blue is shown in Figure 2B. A colorless and transparent visible living cells are not stained with and a small amount of Trypan blue stained by dead cells. The isolated PMNs were 96% viable.

Figure 2: Isation of the PMNs (A) The purity of the isolated PMNs by Wright Giemsa staining. The PMNs were arrowhead (Light microscope, 40X). (B) The viability of the cells stained by Trypan blue. The activated PMNs were arrowhead (Light microscope, 10X).

The cytopathic effect on PMNs at different time points

The bacterial colonies used to infect PMNs had the same number of CFUs. PMNs release ROS to kill pathogens. However, if PMNs fail to produce an effective level of ROS, they will be killed by the pathogens. The population of PMNs in the HPI-infected group was dramatically reduced compared to that in the control group and the ΔHPI-infected group. Moreover, in the ΔHPI-infected group, the number of PMNs also decreased, but it was higher than that in the HPI-infected group (Figure 3).

Figure 3: The population of PMNs in different groups PMNs were infected with E.coli and observed at 4 h, 8 h, 12 h, 16 h, 20 h and 24 h (Light microscope, 40X). The CFU was 3.1 × 108. The PMNs were divided into three groups: the control group, the HPI-infected group and the ΔHPI-infected group. The number of PMNs was counted using a cell counter. The data in the graphs represent the mean ± SEM of at least 3 independent experiments. *P<0.05; **P<0.01, analyzed by ANOVA.

HPI-positive E. coli inhibited ROS production

The effects of HPI on the ROS production of PMNs are shown in Figure 4A. Overall, ROS production in the ΔHPI-infected group was higher than that in the HPI-infected group (P<0.05). ROS production in the HPI-infected group was significantly higher than that in the control group (P<0.05) at 4, 8, and 12 h, but it was reduced at the latter three time points. In the ΔHPI-infected group, the ROS production was higher than in the control group (P<0.05). These results indicated that HPI inhibited the ROS response from the PMNs.

Figure 4: The activity concentration of ROS (IU) in PMNs was detected by ELISA (a) The ROS generation in PMNs at different time point. The PMNs was infected with E.coli and detected at 4 h, 8 h, 12 h, 16 h, 20 h and 24 h. The CFU was 3.1 × 108. The PMNs were divided into three groups: control group, HPIinfected group and ΔHPI-infected group. Data in the graphs represent mean ±SEM of at least 3 independent experiments. *P<0.05; **P<0.01, analyzed by ANOVA; (b) The activity concentration of ROS in PMNs (IU). Hollow circle: ΔHPI-infected group was disposed with PBS; Solid circle: ΔHPI-infected group was disposed with deferoxamine.

To investigate whether the HPI-positive E. coli could reduce the production of ROS by taking up iron, an iron saturation assay was performed. HPI-positive E. coli encodes yersiniabactin, which provide the bacteria with iron during infection. Moreover, HPI also reduces the iron supply of the innate immune cells. The ROS production in the PBS group was unchanged and higher than that in the deferoxamine group (Figure 4B). ROS generation in the deferoxamine group was decreased gradually as the drug concentration was increased.

These results suggest that the bacteria containing the HPI reduce ROS production in PMNs.

The effect on the activation of NADPH oxidase

NADPH is a key enzyme involved in O2- production via the catalysis of O2; this process is called a “respiratory burst”. The HPIinfected group was significantly different from the control group and from the ΔHPI-infected group (P<0.05), except at the 4 h time point (Figure 5). The level of NADPH production in the ΔHPI-infected group was higher than that in the HPI-infected group (P<0.05) after 8 h. These results showed that PMNs produced more NADPH to kill the ΔHPI bacterium. However, in the HPI-infected group, the production of NADPH was less lower, which indicated that HPI can influence NADPH production.

Figure 5: The effect of the high-pathogenicity island (HPI) on activity concentration of nicotinamide adenine dinucleotide phosphate (NADPH) in polymorphonuclear leucocytes (PMNs) (pg/ml). The PMNs were infected with E.coli and NADPH was detected at 4, 8, 12, 16, 20, and 24 h. The CFU was 3.1 × 108. An enzyme-linked immunosorbent assay was performed to detect the concentration of NADPH. The PMNs were divided into three groups: the control group, the HPI-infected group, and the ΔHPI-infected group. The data in the graphs represent the mean ± SEM of at least 3 independent experiments. *P<0.05; **P<0.01, analyzed by ANOVA.

HPI-positive E. coli reduced antioxidant enzyme production

T-SOD and GSH-Px are antioxidant enzymes expressed in PMNs. These enzymes can protect PMNs from ROS-mediated damage. T-SOD can catalyze the conversion of O2- into H2O2, and H2O2 can be catalyzed into H2O by GSH-Px.

Overall, the T-SOD production in the HPI-infected group was higher than that in the control group and in the ΔHPI-infected group (P<0.05) (Figure 6A). T-SOD production was lower in the ΔHPIinfected group than in the control group (P<0.05) and also showed a trend to decrease further. The production of GSH-Px in the HPIinfected group was higher than that in the control group at 4, 8, and 12 h, but was lower at the latter three time points (Figure 6B) (P<0.05). GSH-Px production was lower in the ΔHPI-infected than in the control group (P<0.05).

Figure 6: The effect of the high-pathogenicity island (HPI) on the expression of antioxidant enzymes in respiratory burst. The polymorphonuclear leukocytes (PMNs) were infected with E.coli and detected at 4, 8, 12, 16, 20, and 24 h post infection. The CFU was 3.1 × 108. The chemiluminescence method was used to quantify the levels of total superoxide dismutase (T-SOD) and glutathione peroxidase (GSH-Px). The PMNs were divided into three groups: the control group, the HPI-infected group, and the ΔHPI-infected group. The data in the graphs represent the mean ± SEM of at least 3 independent experiments. *P<0.05; **P<0.01, analyzed by ANOVA.
(A) Activity concentration of T-SOD (U/mL) in PMNs (B) Activity concentration of GSP-Px (U) in PMNs.

The lower production of MPO in HPI-infected group

MPO is a peroxidase expressed in the azurophilic granules of PMNs. The MPO-Fe3+ complex can catalyze the conversion of H2O2 into HOCl, which can kill pathogens. The MPO levels can also reflect the activity of PMNs [16]. As shown in Figure 7, the production of MPO in the HPI-infected group was lower than that in the control group (P<0.05), with a trend toward a further reduction at the latter time points. However, the MPO production in the ΔHPI-infected group was higher than that in the control group and in the HPIinfected group (P<0.05).

Figure 7: The effect of the high-pathogenicity island (HPI) on the activity concentration of myeloperoxidase (MPO) in polymorphonuclear leukocytes (PMNs) (U/L). The PMNs were infected with E.coli and examined at 4, 8, 12, 16, 20, and 24 h post infection. The CFU was 3.1 × 108. The chemiluminescence method was used to quantify the level of MPO. The PMNs were divided into three groups: the control group, the HPI-infected group, and the ΔHPI-infected group. Data in the graphs represent the mean ± SEM of at least 3 independent experiments. *P<0.05; **P<0.01, analyzed by ANOVA.

Discussion

The population of PMNs in the ΔHPI-infected group was reduced in comparison to the control group; however, it was higher than that in the HPI-infected group. The decreased population of PMNs in the HPI- and ΔHPI-infected groups may have resulted from the bactericidal activity. The intracellular ROS may also activate the genes responsible for apoptosis. ROS can cause DNA damage, which initiates a sequence of events that cause cell suicide [21]. ROS can also induce necrosis by acting as second messengers in the death receptor signaling pathways involved in programmed necrosis [22,23]. In the present study, the sharp decrease of PMNs in the HPIinfected group may have resulted from H2O2 interference with ROS signal transduction [24]. H2O2 catalysis via the Fenton Haber-Weiss reaction was prevented, which resulted in the accumulation of H2O2. This effect increased cytotoxicity and induced the apoptosis and necrosis of PMNs [1,25]. The production of a large number of E. coli can lead to excessive nutrient consumption, which can further induce the necrosis of PMNs through starvation. The ability of PMNs to kill pathogens and survive depends on their ability to mount an effective respiratory burst response. The effective production of ROS can ensure PMN survival [26]. ROS production by innate immune cells is inhibited by yersiniabactin, which is produced only by the highpathogenicity bacteria. Yersiniabactin provides iron to the bacteria and, more importantly, prevents ROS production by innate immune cells [27]. HPI-positive E. coli may also increase their pathogenicity by this mechanism.

Iron has been suggested to playing an important role in the production of ROS. A study by Kordower et al. [28] has showed that deferoxamine mesylate exhibits neuroprotective effects on dopaminergic neurons of the nigrostriatal system by reducing oxidative stress [28]. Our results demonstrate that HPI reduces ROS generation by taking up iron. HPI-positive E. coli encodes a high-affinity iron acquisition protein, yersiniabactin, that can competitively utilize iron to prevent the ROS and HOCl responses from the host and escape from being killed [18]. NADPH is a key enzyme in the catalysis of O2 to produce O2-, a process called “respiratory burst.” Later, O2- leads to the formation of other toxic O2 metabolites, which also promote microbicidal mechanisms [29]. O2- can also be converted to· OH via the Fenton Haber-Weiss reaction; ·OH has a high cytopathicity and potential to kill pathogens. The results of NADPH generation may indicate that PMNs require more NADPH to generate ROS to kill ΔHPI bacterium [29]. However, in the present study, the production of NADPH was lower in the HPIinfected group (Figure 5). Interestingly, the increased metabolism of H2O2 can promote NADPH production [30]. HPI-positive E. coli can competitively utilize the iron of PMNs, which can increase H2O2 accumulation and reduce bactericidal ROS generation. These results demonstrate that expression of HPI might also influence NADPH production.

Cells have developed a system for maintaining the oxidantantioxidant balance to protect themselves from damage [10]. The first line of antioxidant defense is SOD, which balances the level of intracellular reactive ROS [31]. SOD can catalyze O2- into H2O2, which can be catalyzed into H2O by GSH-Px. However, this reaction occurs most often in non-phagocytic cells. In PMNs, most H2O2 is catalyzed into HOCl and HO- [9,32]. The increased antioxidant levels may be due to reduced antioxidant consumption resulting from decreased ROS generation. In the ΔHPI-infected group, the accumulation of ROS consumed more T-SOD and GSH-Px to create a balance The H2O2-MPO-HOCl pathway may be important for cytopathogenesis [33]. Low levels of MPO were associated with a low level of HOCl and impaired ability to kill pathogens. Neuroblast phagocytes cannot kill Staphylococcus aureus unless the bacteria are coated with MPO. This finding suggested that the respiratory burst was not sufficient to kill the organisms, but the presence of MPO was required [3]. MPO must combine with Fe3+ to catalyze H2O2 metabolism. HPI-positive E. coli can take up iron, which decreases the efficiency of H2O2-MPO-HOCl metabolism. HPI-positive E. coli can reduce the bactericidal ability through H2O2-MPO-HOCl pathway by consuming iron [34]. Thus the integral MPO system played an important role in killing bacteria.

Conclusions

The present results demonstrate the intimate relationship between HPI expression and E. coli pathogenicity.

PMNs can kill invading pathogens by producing ROS. HPIpositive E. coli reduced the generation of ROS and increased the antioxidant levels, which eventually reduced the population of PMNs (Figure 8). PMNs infected with HPI knockout strains of E. coli yielded opposite results.

Figure 8: Schematic representation of the proposed mechanism of the respiratory burst in polymorphonuclear leukocytes (PMNs). When pathogens invade PMNs, nicotinamide adenine dinucleotide phosphate (NADPH) can catalyze oxygen into superoxide anion radicals (O2-), but O2- cannot cross the cell membrane. Furthermore, O2- can be catalyzed into hydrogen peroxide (H2O2) by superoxide dismutase (SOD). However, H2O2 has a low oxidative ability and thus cannot kill bacteria effectively. PMNs can catalyze other reactive oxygen species to kill bacteria. Fe3+ and myeloperoxidase (Fe3+) catalyze H2O2 into HO- and HOCl, respectively, which can effectively kill pathogens. In this reaction, H2O2 can be catalyzed into H2O by antioxidase glutathione peroxidase (GSH-Px) in the case of self-injury caused by bactericidal reactive oxygen species (ROS). In this oxidant-antioxidant system, ΔHPI strains can induce a reduction in ROS and an increase in antioxidases (T-SOD, GSH-Px), but high-pathogenicity island (HPI) strains produce opposite effects. Consequently, when PMNs were infected with E. coli, the HPI strain effectively killed PMNs and survived in large numbers, while the outcome was reversed for the ΔHPI strain.

HPI are able to change the oxidative stress situation in PMNs, which might be useful for understanding the virulence of HPIpositive E. coli.

Funding

This study was supported by the National Natural Science Foundation of China (Grant No. 31260594 and 31660704), which supported study, collection and analysis. The Technology System Construction of the swine industry in modern agriculture in the Yunnan Province, which supported interpretation of data.

References

Track Your Manuscript

Share This Page